and maceration, require a lot of solvent, time, and
energy, but are popular and effective. However, new
extraction technologies are being actively introduced, e.g.
ultrasonic, microwave, infrared, and fluid supercritical
extractions. They are energy saving and environmentally
friendly, according to one of the latest books on the
extraction of biological active substances from plant and
animal raw materials [23]. Still, an optimal extraction
technology should be simple, safe, reproducible,
inexpensive, and suitable for industrial use [24].
Ultrasonic (US) extraction is a fairly cheap method
that requires minimal hardware design [25]. It destroys
cell walls (lysis) and disintegrates individual cellular
structures and the cell as a whole, which increases
the number of components that enter the extract. US
produces a mechanical effect: the solvent penetrates
into the matrix of berries, thus increasing the area of the
contact surface between the solid and the liquid phases
[26]. Moreover, US waves can cause some undesirable
chemical processes that can change the chemical
composition, degrade the target compounds, and cause
free radicals in gas bubbles [27]. Therefore, a set of
experiments is required to define the optimal extraction
conditions, i.e. time, temperature, power, and ultrasonic
frequency.
Microwave (MW) radiation is another possible way
to increase extraction efficiency [28]. MW radiation is
a popular means of extraction, as far as low-molecular
compounds from plant raw material are concerned.
The research objective was to obtain a semi-finished
raspberry product using MW and US processing, as well
as to study its antioxidant, anti-carcinogenic, sensory,
physico-chemical, and microbiological properties.
STUDY OBJECTS AND METHODS
The experiments were performed on the premises
of the Department of Technology and Catering at the
Samara State Technical University (Samara, Russia).
The anti-inflammatory and cytostatic, or cytotoxic,
properties were determined in the N.N. Blokhin National
Medical Research Oncology Center (Moscow, Russia).
The research featured a variety of fresh raspberries
(Rúbus idáeus L.) harvested in the Samara region
(53°12′N - 50°06′E) in 2017. The raspberries were
provided by the Research Institute of Horticulture and
Medicinal Plants ‘Zhigulyovskie Sady’ (Samara, Russia).
Determination of the antioxidant properties
indicators.
Chemicals and reagents. The experiment
used ethanol and distilled water. The Folin-
Ciocalteu reagent (FCR) and the gallic acid were
provided by the Fluka company (Germany). The
DPPH (2,2-diphenyl-1-picrylhydrazyl), sodium nitrite,
48
Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Х
aluminum chloride, sodium carbonate, and linoleic acid
were ordered from Sigma-Aldrich, Inc. The 2,4,6-tri(2-
pyridyl)-s-triazine (TPTZ) was purchased from
Fluka Chemicals (Spain). Other chemicals included
hydrochloric acid, potassium chloride, acetic acid,
sodium acetate, sodium phosphate, ferric chloride (II),
ferric chloride (III), and ammonium rodanide.
Phenolic compounds. The content of total phenols
was estimated using a modified version of the FCR
method [29]. Gallic acid was used as a standard: an
aqueous solution of gallic acid (200 mg in 1000 cm3) was
diluted with distilled water to obtain the concentrations
appropriate for the calibration curve. The experiment
involved 0.50 cm3 of the analysed substance or standard
gallic acid, 4.00 cm3 of distilled water, 0.25 cm3 of FCR
reagent, and 0.25 cm3 of a saturated aqueous solution
of sodium carbonate. The samples were shaken and
kept in the dark at room temperature for 30 min. The
absorption coefficient was determined at 725 nm with
a spectrophotometer. Results were expressed in mg
equivalent of gallic acid per 100g of dry weight. The
experiment was performed in triplicate.
Flavonoids. The content of flavanoids was
determined using a modified method described
Demidova et al [30]. 0.50 cm3 of the analysed substance
or standard catechin solution was put in a 10 cm3
measuring tube. After that, 2.50 cm3 of distilled water
was added at the time zero followed by 0.15 cm3 of a
5% aqueous solution of sodium nitrate. After 5 minutes,
0.30 cm3 of a 10% aqueous solution of aluminum
chloride was added and kept for another 5 min. The
absorption coefficient was measured at 510 nm. The
content of flavonoids was expressed in mg equivalent
of catechin per 100g of dry weight. The experiment was
performed in triplicate.
Anthocyanins. To define the total content of
anthocyanins, the absorption coefficient was measured
at two different pH values (1.0 and 4.5) at 515 and 700
nm [31]. The content of anthocyanins was expressed in
mg equivalent of cyanidin-3-glycoside per 100 g of dry
matter. The experiment was performed in triplicate.
Antioxidant activity in the linoleic acid system.
The antioxidant activity in the linoleic acid system
was determined according to the method described
Karabegovic [32]. 0.5 cm3 of ethanol, 0.5 cm3 of distilled
water, 1 cm3 o f l inoleic a cid, a nd 2 c m3 of phosphate
buffer (pH 7.0) were added to 1.0 cm3 of the analysed
substance. The mixture was kept at 40°C for 120 h.
Then an aliquot part (0.1 cm3) was isolated from the
mixture. After that, 9.7 cm3 of 75% ethanol and 0.1 cm3
of a 30% ammonium rhodanide solution were added to
the aliquot and allowed to stand for 4 min. Subsequently,
0.1 cm3 of ferric chloride (II) solution was added to the
mixture (0.2 M in 3.5% of HCl). A spectrophotometer
was used to measure the optical density of the mixture
at 500 nm. The control sample contained all the reagents
but the extract. The antioxidant activity was expressed
in percent of inhibition of linoleic acid oxidation. The
experiment was performed in triplicate.
Antioxidant activity by DPPH. The antioxidant
properties of the samples were measured using the
method described Cheigh et al [33]. The method is based
on the ability of the antioxidants of the raw material to
bind the stable chromogen radical of 2,2-diphenyl-1-
picrylhydrazyl (DPPH). 4 mg of DPPH was dissolved
in 100 cm3 of ethanol. The aliquots were dissolved in
100 cm3 of distilled water in the quantities of 0.05, 0.10,
0.40, 0.80, 1.00, and 5.00 cm3. Then, 0.2 cm3 of each
solution was added to 2.0 cm3 of the DPPH solution at
20°C and kept in the dark for 30 min. The transmittance
was determined at 517 nm. The antiradical activity was
expressed as the concentration of the original object in
mg/cm3, at which 50% of the radicals were bound. The
experiment was performed in triplicate.
FRAP method. The restoring force of the analysed
substance was determined by the FRAP method [34].
A freshly prepared FRAP solution included 10 cm3
of acetate buffer (pH 3.6), 1 cm3 of a 10% solution
of ferric chloride (III) and 1 cm3 of TPTZ solution
(2,4,6-tripyridyl-s-triazine) (10 mmol/l TPTZ in 40
mmol/1000 cm3 of HCl). The solution was kept at 37°C
for 10 min. After that, 3.0 cm3 of distilled water and
1 cm3 of FRAP solution were added to the analysed
substance (0.1 cm3). The mixture was allowed to stand
at 37°C for 4 min. The optical density was measured at
593 nm. The restoring force was determined according
to the calibration graph and expressed in mmol of Fe2 +/1
kg of the raw material. The experiment was performed
in triplicate.
The sensory properties of the raspberry extract were
defined according to State Standard 8756.1-2017*.
The microbiological studies of the semi-finished
product were performed according to State Standards
31659-2012** a nd S tate S tandard 3 0712-2001*** in
licenced testing laboratory No. ROSS RU.0001.510137.
The physical and chemical properties were
determined according to State Standards 34128-
2017**** a nd S tate S tandards 3 4127-2017*****.
The content of ethanol in the raspberry extract was
* State Standard 8756.1-2017. Fruit, vegetable and mushroom
products. Methods for determination of organoleptic
characteristics, components fraction of total mass and net
mass or volume. Mocsow: Standartinform; 2017. 12 p.
** State Standards 31659-2012. Food products. Method for
the detection of Salmonella spp. Mocsow: Standartinform;
2014. 21 p.
*** State Standard 30712-2001. Products of non-alcoholic
industry. Methods of microbiological analysis. Mocsow:
Standartinform; 2010. 11 p.
**** State Standards 34128-2017. Juice products. Refractometric
method for the determination of soluble solids mass
concentration. Mocsow: Standartinform; 2017. 8 p.
***** State Standards 34127-2017. Juice products. Determination
of titratable acidity by method of potentiometric
titration. Mocsow: Standartinform; 2017. 8 p.
49
Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Х
determined according to State Standard ISO 2448-
2013******. The experiments were performed in
triplicate.
Statistical data processing. The statistical
processing of the results was performed with the help
of Student’s t-test to determine M ± m, where M is the
mean value, m is the standard error of the mean (the
standard deviation √n) was defined using the Microsoft
Excel software.
Determination of potential anticarcinogenic
properties indicators.
Anti-inflammatory drugs are known to produce an
inhibitory effect on the pro-inflammatory pathways of
cells, including COX2, iNOS, and IL-8. It is currently
considered a proven fact that these drugs exert an
anticarcinogenic effect in vivo. That is why the present
study featured these very genes and the effect of
raspberry extract on them to determine the potential
anticanceragenic activity of the product.
The study used HCT-116 colon cancer cell line [35].
The cells were cultured at 37°C in standard DMEM
medium containing 5% fetal calf serum (PAA,
Australia) and gentamicin (50 U/cm3) (PanEko, Russia)
and in 5% of CO2.
Cell viability study (MTT-test). The cells were
dispersed into 96-well plates (BDMicro-FinePlus, USA).
There were 3×103 cells in 190 μl of culture medium.
After that, the cells were incubated for 24 h. Serial
dilutions of raspberries were prepared on the day of
the experiment. The cells were incubated with the
extract for 72 h at concentrations of 0.03125–2% (v/v).
Then 20μl of the MTT reagent solution were added in
the ratio of 5 mg/cm3 (PanEko, Russia) in Hanks salt
solution (PanEko, Russia). The solution was allowed
to uncubate at 37°C for 2 h until it turned violet. The
formazan was then dissolved in 200 μl of dimethyl
sulfoxide (DMSO, PanEko, Russia) and incubated
at 37°C. After the formazan crystals had completely
dissolved, the optical density of the wells was measured
at a wavelength of 570 nm using a MultiScan MCC
340 multiwell spectrophotometer (Labsystems, USA).
The data were presented as the optical density of the
experimental samples vs. that of the control sample.
The optical density in the control sample was taken for
100%. The cells in the control sample were incubated in
a 1% ethanol solution.
RNA isolation. The total cellular RNA was isolated
using an RNA isolation kit. The RNA concentration
was determined with a spectrophotometer according
to the optical density of the solution at a wavelength of
260 nm. The absence of impurities in the sample was
stated by the ratio of the optical density of the solution at
a wavelength of 260 nm and 280 nm.
Reverse transcription reaction. Reverse
transcription was used to obtain cDNA. 1μg of
RNA was mixed with 0.4 μg of random hexamer
****** State Standard ISO 2448-2013. Fruit and vegetable
products. Determination of ethanol content. Mocsow:
Standartinform; 2014. 11 p.
oligonucleotides, denatured at 25°C, and cooled on ice.
The reverse transcription mixture included: 2 units of
reverse transcriptase MMLV, a suitable buffer, 2 mM
of dithiothreitol, 0.5 units of ribonuclease inhibitor,
0.5 mM of dNTP, and ≤ 20 μl of distilled water.
The reaction lasted 1 h at 37°C. After that, reverse
transcriptase was inactivated at 95°C for 5 min, which
stopped the reaction. After adding 80 μl of distilled
water, the aliquots were used for real-time PCR
amplification with specific primers.
Quantitative real-time PCR analysis. After
the reverse transcription reaction, the samples were
diluted 1:10 with sterile deionised water to obtain
working dilutions of cDNA. 5 μl of the cDNA working
solution was added to 20 μl of the reaction mixture that
contained SYBR Green Master Mix, 500 nM of the
reverse primers and 500 nM of direct primers. A Bio-
Rad iQ5 PCR analyser was used to perform a real-time
quantitative PCR analysis. The amplification programme
was as follows: 95°C – 10 min, 40 cycles (95°C – 15 s,
60°C – 30 s, 72°C – 30 s). The relative change in the
expression of the mRNA was calculated using the ΔΔCt
method. The ΔΔCt was determined by subtracting the
average ΔCt of the control sample from the ΔCt of the
experimental samples [36]. For each gene, a PCR analysis
was performed in triplicate, and the melting curves were
obtained for each primer pair to confirm their specificity.
To analyse the melting curves, the temperature was
raised from 55°C to 95°C at a pace of 0.5°C. The
ribosomal protein gene L27 (Rpl27) was used for control.
The primers for cDNA amplification were designed
using the Primer-Bank database and the Oligo 6
software [37]. Table 1 shows the primer sequences.
Statistical data processing. Statistical processing of
the results performed with the help of Student’s t-test to
determine M ± m, where M is the mean value, m is the
standard error of the mean (standard deviation √n) was
defined using the Microsoft Excel software.
RESULTS AND DISCUSSION
The research compares the antioxidant properties of
raspberry extracts obtained by maceration, ultrasonic
treatment, and microwave processing. All the extracts
were obtained using 50% ethanol, while the raw material
vs. solvent ratio was 1:10 (w/v).
Table 1 Primer sequences
Gene Sequence (forward/reverse), 5’-3’
RPL27 ACC GCT ACC CCC GCA AAG TG
CCC GTC GGG CCT TGC GTT TA
COX2 CCGGGTACAATCGCACTTAT
GGCGCTCAGCCATACAG
iNOS CGGCCATCACCGTGTTCCCC
TGCAGTCGAGTGGTGGTCCA
IL-8 TCCTGATTTCTGCAGCTCTGTG
TCCAGACAGAGCTCTCTTCCAT
50
Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Х
The maceration extract was obtained by storing the
raw material and the solvent at 40°C for 120 min.
The US extract was obtained using an Elmasonic S
15H device at a frequency of 50 kHz at 40°C for 120 min.
The MW extract was obtained by using microwave
irradiation with a irradiation rate of 90 W for 1 min.
Figure 1 shows the total content of phenols,
flavonoids, and anthocyanins.
US radiation resulted in the biggest content of
phenolic substances: it increased by 1.50 times as
compared with classical maceration. MW radiation
produced nothing but minor changes: the content of total
phenolic substances in the extract increased by 1.06 times.
The US and MW processing also increased the
extraction of flavonoids by 1.44 and 1.13 times,
respectively.
All the methods showed nearly the same content of
anthocyanins in the extracts.
Figure 1 Total content of antioxidants in the raspberry
extracts: PhS – total content of phenolic substances, mg
of gallic acid/100 g of raw material; Fl – total content of
flavonoids, mg of catechin/100 g of raw material; Ac – total
content of anthocyanins, mg of cyanidin-3-glycoside/100 g
of raw material). (1) maceration, (2) US extraction,
(3) MW extraction
Table 2 Antioxidant properties of the raspberry extracts
Index Maceration US
extraction
MW
extraction
Restoring force according
to the FRAP method,
mmol Fe2+/1 kg of raw
material
7.92 10.08 9.09
Antiradical activity by
the DPPH method, EC50,
mg/cm3
10.1 31.5 28.0
Antioxidant activity in
the system of linoleic
acid,% of inhibition
16.6 57.5 54.1
Figure 2 Procedure chart for raspberry extract production
0
150
300
450
600
750
PhS Fl Ac
mg/100 g of raw material
1 2 3
0.0
0.2
0.4
0.6
0.8
1.0
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Контроль Малина, 0,063 % Малина, 0,031 %
0
150
300
450
600
750
PhS Fl Ac
mg/100 g of raw material
1 2 3
0.6
0.8
1.0
Raw material
delivery
Selection Washing Grinding
US extraction at 50kHz,
40°C, 120 min, 1:10 Filtration Concentrating up
to ωPCV 65%
Pouring into aseptic
vessels
50% ethanol
Pulp
Water-ethanol mixture Storage and offtake,
12 months, 4–7°C, with no
exposure to light and air
Thus, both US and MW methods increased the
content of biologically active substances in the raspberry
extracts. US extraction proved to have the greatest
impact on the content of phenolic substances and
flavonoids, while the content of anthocyanins remained
almost the same in different types of extraction.
Table 2 demonstrates the antioxidant properties of
the raspberry extracts.
The inhibitory effect of DPPH free radicals increased
by 1.15 and 1.27 during MW and US extractions,
respectively.
The restoring force of the US extract increased as
compared with MW and maceration extracts.
In addition, US extraction increased the ability of the
raspberry extract to inhibit linoleic acid by 3.46 times.
Similarly, additional treatment with US or MW
radiation increased the antioxidant properties of the
semi-finished products, if compared with classical
maceration.
Thus, US processing is necessary to obtain a
raspberry extract with a high content of physiologically
active substances and high antioxidant properties.
The study introduces a optimal conditions for
raspberry extract production. The new technological
scheme is given in Fig. 2.
51
Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Х
The experimental data made it possible to define the
best technological modes: ethanol = 50%, US radiation
frequency = 35 kHz, temperature = 40 ± 5°C, time = 120
min, raw materials vs. solvent ratio = 1:10. A circulation
vacuum evaporator concentrated the extract until the
content of soluble solids was 65% and the mass fraction
of ethanol was ≤ 1.0%.
The extract was then analysed by sensory,
microbiological, physicochemical, and antioxidant
properties (Table 3).
Chronic inflammation is one of the main etiological
factors that trigger certain types of cancer. As a result,
some anti-inflammatory drugs, e.g. ibuprofen, have an
anti-carcinogenic effect on colon cancer.
The main objective of this research was to study the
anti-inflammatory properties of the raspberry extract.
A set of experiments was conducted to study its effect
on the expression of the genes of individual components
of the anti-inflammatory pathway. A colon cancer cell
line was studied by the RT-PCR method to measure the
effect of non-toxic extract doses on the expression of the
following genes: cyclooxygenase 2 (COX-2), induced NO
synthase (iNOS) and interleukin 8 (IL-8) [38]. The antiinflammatory
effect of the raspberry extract indicates its
potential anticarcinogenic activity.
The functional activity of the COX-2 gene is directly
related to inflammation. This gene is expressed by
macrophages, synoviocytes, fibroblasts, smooth vascular
muscles, chondrocytes, and endothelial cells after they
have been induced with cytokines or growth factors.
COX-2-induced prostaglandins – directly or indirectly
– enhance the production of the enzyme according to
the positive feedback mechanism [39]. Inhibition of
COX-2 is considered as one of the main mechanisms
of the anti-inflammatory activity of nonsteroidal antiinflammatory
drugs (NSAIDs). Selective inhibition of
this cyclooxygenase can minimise various side effects
observed during the inhibition of cyclooxygenase 1.
COX-2 plays an important role in the development
of inflammatory processes and carcinogenesis in the
gastrointestinal tract. An increased COX-2 expression
was observed in 85% of gastrointestinal tumours,
which also correlated with low survival. Animal studies
showed that deleting COX-2 or treating animals with
selective COX-2 inhibitors reduced the number, size,
and multiplicity of tumours. COX-2 causes tumour
progression as it induces the expression of anti-apoptotic
proteins of the Bcl-2 family, which leads to apoptosis
resistance in the future [37].
IL-8 i s k nown a s a T -cell c hemotactic f actor
and a neurophil activating factor (NAF) [40, 41]. It
belongs to the group of chemokines, which provide
chemotaxis in the area of inflammation of neutrophils,
monocytes, eosinophils, and T-cells. IL-8 possesses
pronounced pro-inflammatory properties. It causes
the expression of intercellular adhesion molecules and
enhances neutrophil adherence to endothelial cells
and subendothelial matrix proteins. Hence, it is an
important mediator of inflammatory response [42].
IL-8 is produced b y macrophages, lymphocytes,
epithelial cells, fibroblasts, and epidermal cells. IL-8 also
regulates pro-inflammatory angiogenesis. This cytokine
enhances the expression of vascular endothelial growth
factor A (VEGF-A) by endothelial cells and increases the
expression of vascular growth receptor 2 (VEGFR2) [43].
iNOS expression is regulated by pro-inflammatory
cytokines (tumour necrosis factor-alpha (TNF-α),
interleukin-1β (IL-1β), interferon-γ (IFN-γ), hypoxia,
oxidative stress, and, according to recent studies, by
Hsp70 heat shock protein. Inhibition of iNOS results
from the suppression of the pro-inflammatory and
proliferative pathways NF-κB and JAK-STAT [44].
The expression of these genes can denote the
presence or absence of the anti-inflammatory effect
of the extracts on colon cells. This research did not
study the anticarcinogenic properties of the extract
Table 3 Properties of the raspberry extract
Indicators Raspberry extract
Sensory
properties
Appearance Transparent liquid without residue
Taste and aroma Bitter-sweet, like raspberry juice
Colour Bright raspberry
Physical and
chemical
indicators
Soluble solids, % 65.0 ± 0.1
Titratable acidity,% (expressed as malic acid) 5.50 ± 0.02
Mass fraction of ethanol, % < 1.0
Antioxidant
properties
Total content of phenolic substances, mg of gallic acid/100 g of starting material 654.0 ± 25
Total content of flavonoids, mg catechin/100 g of starting material 194.0 ± 13
Total content of anthocyanins, mg cyanidin-3-glycoside/100 g of dry matter 50.81 ± 2.14
Antiradical activity according to the DPPH method, EC50, mg/cm3 2.02 ± 0.01
Restoring force according to the FRAP method, mmol Fe2+/1 kg
of starting material
22.31 ± 0.04
Antioxidant activity in the smooth system of linoleic acid, % of berry inhibition 68.35 ± 0.07
Microbial
attributes
Total visible count, CFU/g Not detected
Coliforms, CFU/g Not detected
Yeast and mould, CFU/g Not detected
52
Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Х
components; however, its results may indicate the
feasibility of in vivo experiments to determine the
anticarcinogenic properties of the raspberry extract.
We performed an MTT test to define the cytotoxicity
of the raspberry extract. A wide range of concentrations
(0.03125–2%, v/v) showed that the raspberry extract has a
cytotoxic effect on colon cancer cells HCT-116 (Table 4).
Next, a non-toxic concentration of the raspberry
extract was used to define the working concentration.
It was used to study the effect of the extract on the
expression level of COX-2, iNOS, and IL-8. Working
concentrations used were 0.0625 and 0.03125% (v/v).
A PCR analysis of COX-2 expression was performed
after colon cancer cells of the HCT-116 line had
undergone a proper treatment. The analysis showed
that the raspberry extract had an inhibitory effect on
the expression of this gene. The effect of the extract on
COX-2 expression depended on the dose. Figure 3 shows
that when the concentration of the extract was 0.063%,
COX-2 expression fell down to 43%, i.e. by 2.3 times.
When the concentration of the extract was 0.031%, it fell
down to 22%, i.e. by 4.5 times.
Figure 4 shows some dependencies revealed by the
analysis of iNOS expression. When treating the cells
with the raspberry extract, both concentrations resulted
in a decrease in iNOS expression by almost 2 times:
47% and 42% for concentrations of 0.063% and 0.031 %,
respectively.
The PCR analysis showed that the raspberry
extract also inhibited IL-8 expression. When
HCT-116 cells were treated with the raspberry extract at
the concentration of 0.063%, it inhibited IL-8 expression
by 54%, while the concentration of 0.031% inhibited
IL-8 expression by 42%. Fig.5 shows the effect of the
raspberry extract on IL-8 expression.
CONCLUSION
The research results made it possible to draw the
following conclusions:
(1) US or MW treatment improved the extraction
process and increased the content of biologically active
cells and their antioxidant properties. US extraction had
a greater impact on the content of phenolic substances
and flavonoids, whereas the content of anthocyanins
remained almost the same after different types of
extraction.
(2) The experimental data made it possible to define
the optimal technological parameters: ethanol = 50%,
US radiation = 35 kHz, temperature = 40 ± 5°C,
time = 120 min, raw materials vs. solvent ratio = 1:10.
(3) The study defined the sensory, physical, and
chemical quality and safety indicators for raspberry
extracts, which did not contradict with the national
regulatory documentation.
(4) The raspberry extract was found able to reduce
the expression of pro-inflammatory COX-2, iNOS,
and IL-8 genes. This semi-finished product can be
Table 4 Effect of raspberry extract on cell viability of the
supercritical HCT-116
Cell viability IC50 IC30 IC10
Volume
concentration, %
0.25 ± 0.05 0.165 ± 0.01 0.09 ± 0.03
Figure 3 Effect of the raspberry extract on COX-2 expression.
The quantitative PCR analysis of COX-2 expression was
performed after HCT-116 cells had been incubated for 24 h at
working concentrations (0.063% and 0.031%). The number of
PCR products was assessed and normalised according to the
amount of the PCR product of the Rpl27 gene
0
150
300
450
600
750
PhS Fl Ac
mg/100 g of raw material
1 2 3
0.0
0.2
0.4
0.6
0.8
1.0
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Контроль Малина, 0,063 % Малина, 0,031 %
Figure 4 Effect of the raspberry extract on iNOS expression.
The quantitative PCR analysis of iNOS expression was
performed after HCT-116 cells had been incubated for 24 hours
at working concentrations (0.063% and 0.031%). The number
of PCR products was assessed and normalized according to
the amount of the PCR product of the Rpl27 gene
0
150
300
450
600
750
PhS Fl Ac
mg/100 g of raw material
1 2 3
0.0
0.2
0.4
0.6
0.8
1.0
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Контроль Малина, 0,063 % Малина, 0,031 %
Figure 5 Effect of the raspberry extract on IL-8 expression.
The quantitative PCR analysis of IL-8 expression was
performed after HCT-116 cells had been incubated for 24 hours
at working concentrations (0.063% and 0.031%). The number
of PCR products was assessed and normalized according to
the amount of the PCR product of the Rpl27 gene
0.0
0.2
0.4
0.6
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Контроль Малина, 0,063 % Малина, 0,031 %
0.0
0.2
0.4
0.6
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Control Raspberry, 0.063% Raspberry, 0.031%
0.0
0.2
0.4
0.6
0.8
1.0
Контроль Малина, 0,063 % Малина, 0,031 %
53
Eremeeva N.B. et al. Foods and Raw Materials, 2019, vol. 7, no. 2, pp. Х–Х
recommended for further studies of the effect it has on
induced COX-2, iNOS, and IL-8 expression, as well as
for in vivo studies of its anticarcinogenic activity.
CONFLICT OF INTEREST
The authors declare that there is no conflict of
interest related to this article.

1. Taylor TM. Handbook of Natural Antimicrobials for Food Safety and Quality. USA: Elsevier Science, 2014. 442 p.

2. Bobinaite R, Viškelis P, Šarkinas A, Venskutonis PR. Phytochemical composition, antioxidant and antimicrobial properties of rasberry fruit, pulp, and marc extracts. CyTA - Journal of Food. 2013;11(4):334-342. DOI: https://doi.org/10.1080/19476337.2013.766265.

3. Wallace CA, Sperber WS, Mortimore SE. Food Safety for the 21st Century: Managing HACCP and Food Safety Throughout the Global Supply Chain. Wiley; 2018. 477 p. DOI: https://doi.org/10.1002/9781444328653.

4. Kapetanakou AE, Skandamis PN. Applications of active packaging for increasing microbial stability in foods: natural volatile antimicrobial compounds. Current Opinion in Food Science. 2016;12:1-12. DOI: https://doi.org/10.1016/j.cofs.2016.06.001.

5. Boo H-O, Hwang S-J, Bae C-S, Park S-H, Heo B-G, Gorinstein S. Extraction and characterization of some natural plant pigments. Industrial Crops and Products. 2012;40(1):129-135. DOI: https://doi.org/10.1016/j.indcrop.2012.02.042.

6. Tian Y, Liimatainen J, Puganen A, Alakomi H-L, Sinkkonen J, Yang B. Sephadex LH-20 fractionation and bioactivities of phenolic compounds from extracts of Finnish berry plants. Food Research International. 2018;113:115-130. DOI: https://doi.org/10.1016/j.foodres.2018.06.041.

7. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer Journal for Clinicians. 2012;62(1):10-29. DOI: https://doi.org/10.3322/caac.20138.

8. Zanini S, Marzotto M, Giovinazzo F, Bassi C, Bellavite P. Effects of Dietary Components on Cancer of the Digestive System. Critical Reviews in Food Science and Nutrition. 2015;55(13):1870-1885. DOI: https://doi.org/10.1080/10408398.2012.732126.

9. Kushi LH, Doyle C, McCullough M, Rock CL, Demark-Wahnefried W, Bandera EV, et al. American Cancer Society guidelines on nutrition and physical activity for cancer prevention: reducing the risk of cancer with healthy food choices and physical activity. CA Cancer Journal for Clinicians. 2012;62(1):30-67. DOI: https://doi.org/10.3322/caac.20140.

10. Zhao T-T, Jin F, Li J-G, Xu Y-Y, Dong H-T, Liu Q, et al. Dietary isoflavones or isoflavone-rich food intake and breast cancer risk: A meta-analysis of prospective cohort studies. Clinical Nutrition. 2019;38(1):136-145. DOI: https://doi.org/10.1016/j.clnu.2017.12.006.

11. Teng H, Fang T, Lin Q, Song H, Liu B, Chen L. Red raspberry and its anthocyanins: Bioactivity beyond antioxidant capacity. Trends in Food Science and Technology. 2017;66:153-165. DOI: https://doi.org/10.1016/j.tifs.2017.05.015

12. Golubtsova YuV. Physical and chemical indicators and merchandasing assessment of wild strawberry, gooseberry, cherry, raspberry, banana, wild rose and kiwi. Foods and Raw Materials. 2017;5(1):154-164. DOI: https://doi.org/10.21179/2308-4057-2017-1-154-164.

13. Zhidyokhina TV. Industrial assortment of raspberry and its productivity in the black-earth region. The Bulletin of KrasGAU. 2015;109(10):131-135. (In Russ.).

14. Miret JA, Munné-Bosch S. Abscisic acid and pyrabactin improve vitamin C contents in raspberries. Food Chemistry.2016;203:216-223 DOI: https://doi.org/10.1016/j.foodchem.2016.02.046.

15. Zhang L, Li J, Hogan S, Chung H, Welbaum GE, Zhou K. Inhibitory effect of raspberries on starch digestive enzyme and their antioxidant properties and phenolic composition. Food Chemistry. 2015;119:592-599. DOI: https://doi.org/10.1016/j.foodchem.2009.06.063.

16. Landele JM. Ellagitannis, ellagicacid and their derived metabolites: A review about source, metabolism, functions and health. Food Research International. 2011;44(5):1150-1160. DOI: https://doi.org/10.1016/j.foodres.2011.04.027.

17. Luchina NA. Technological Properties of Raspberries Grown in the Novosibirsk Region. Food Industry. 2015;(8):22-24. (In Russ.).

18. Zhbanova EV. Biochemical characterization of fruits from raspberry vor gene pool under the circumstances of the Central Chernozem Zone (Michurinsk). Collection of scientific works SNBG. 2017;144-1:182-186. (In Russ.).

19. Xiao T, Guo Z, Bi X, Zhao Y. Polyphenolic profile as well as anti-oxidant and anti-diabetes effects of extracts from freeze-dried black raspberries. Journal of Functional Foods. 2017;31:179-187. DOI: https://doi.org/10.1016/j.jff.2017.01.038.

20. Terletskaya VA, Rubanka EV, Zinchenko IN. Influence of technological factors on the process of black chokebery extraction. Food Processing: Techniques and Technology. 2013;31(4):127-131. (In Russ.).

21. Polyakov VA, Abramova IM, Zenina GP, Aristarhova TYu, Stekanova GV. Ripple Effect on the Extraction Process in the Preparation of Fruit Drinks Fortified for Distillery. Beer and beverages. 2016;(6):42-45. (In Russ.).

22. Khramtsov AG, Evdokimov IA, Lodygin AD, Budkevich RO. Technology development for the food industry: a conceptual model. Foods and Raw Materials. 2014;2(1):22-26. DOI: https://doi.org/10.12737/4121.

23. Meireles MAA. Extracting Bioactive Compounds for Food Products. Theory and Applications. Bova Raton: CRC Press; 2009. 464 p.

24. Vongsak B, Sithisarn P, Mangmool S, Thongpraditchote S, Wongkrajang Y, Gritsanapan W. Maximizing total phenolics, total flavonoids contents and antioxidant activity of Moringa oleifera leaf extract by the appropriate extraction method. Industrial Crops and Products. 2013;44:566-571. DOI: https://doi.org/10.1016/j.indcrop.2012.09.021.

25. Khoei M, Chekin F. The ultrasound-assisted aqueous extraction of rice bran oil. Food Chemistry. 2016;194:503-507. DOI: https://doi.org/10.1016/j.foodchem.2015.08.068.

26. Nipornram S, Tochampa W, Rattanatraiwong P, Singanusong R. Optimization of low power ultrasound-assisted extraction of phenolic compounds from mandarin (Citrus reticulata Blanco cv. Sainampueng) peel. Food Chemistry. 2018;241:338-345. DOI: https://doi.org/10.1016/j.foodchem.2017.08.114.

27. Espada-Bellido E, Ferreiro-González M, Carrera C, Palma M, Barroso CG, Barbero GF. Optimization of the ultrasound-assisted extraction of anthocyanins and total phenolic compounds in mulberry (Morus nigra) pulp. Food Chemistry. 2017;219:23-32. DOI: https://doi.org/10.1016/j.foodchem.2016.09.122.

28. Markin VI, Cheprasova MIu, Bazarnova NG. Basic directions of use microwave radiation in the processing of plant raw material (review). Chemistry of plant raw material. 2014;(4):21-42. (In Russ.). DOI: https://doi.org/10.14258/jcprm.201404597.

29. Cai M, Hou W, Lv Y, Sun P. Behavior and rejection mechanisms of fruit juice phenolic compounds in model solution during nanofiltration. Journal of Food Engineering. 2017;195:97-104. DOI: https://doi.org/10.1016/j.jfoodeng.2016.09.024.

30. Demidova AV, Makarova NV. Influence of blanching on the physical and chemical properties and antioxidant activity of fruit raw materials cherries, plums, blank chokeberry, strawberry. Food industry. 2016;(2):40-43. (In Russ.).

31. Strycova AD, Makarova NV. Frozen Berries - Effective Antioxidant for Whole Year. Food industry. 2013;(3):28-31. (In Russ.).

32. Karabegovic IT, Stojičević SS, Veličković DT, Todorović ZB, Nikolić NT, Lazić ML. The effect of different extraction techniques on the composition and antioxidant activity of cherry laurel (Prunus laurocerasus) leaf and fruit extracts. Industrial Crops and Products. 2014;54:142-148. DOI: https://doi.org/10.1016/j.indcrop.2013.12.047.

33. Cheigh C-I, Chung E-Y, Chung M-S. Enhanced extraction of flavanones hesperidin and narirutin from Citrus unshiu peel using subcritical water. Journal of Food Engineering. 2012;110(3):472-477. DOI: https://doi.org/10.1016/j.jfoodeng.2011.12.019.

34. M’hiri N, Ioannou I, Mihoubi Boudhrioua N, Ghoul M. Effect of different operating conditions on the extraction of phenolic compounds in orange peel. Food and Bioproducts Processing. 2015;69:161-170. DOI: https://doi.org/10.1016/j.fbp.2015.07.010.

35. Yao C-Y, Yang J-Y, Xu Z-L, Wang H, Lei,H-T, Sun Y-M, et al. Indirect Competitive Enzyme-Linked Immunosorbent Assay for Detection of Tylosin in Milk and Water Samples. Chinese Journal of Analytical Chemistry. 2018;46(8):1275-1281. DOI: https://doi.org/10.1016/S1872-2040(18)61106-5.

36. Pal V, Saxena A, Singh S, Kumar S, Goel AK. Development of a TaqMan Real-Time Polymerase Chain Reaction Assay for Detection of Burkholderia mallei. Journal of Equine Veterinary Science. 2017;58:58-63. DOI: https://doi.org/10.1016/j.jevs.2017.08.008.

37. PCR Primers for Gene Expression Detection and Quantification [Internet]. [cited 2018 Sep 01]. Available from: http://pga.mgh.harvard.edu/primerbank/.

38. Luo , Zhang H. The role of proinflammatory pathways in the pathogenesis of colitis-associated colorectal cancer. Mediators of Inflammation. 2017;2017. DOI: https://doi.org/10.1155/2017/5126048.

39. Nile SH, Ko EY, Kim DH, Keum Y-S. Screening of ferulic acid related compounds as inhibitors of xanthine oxidase and cyclooxygenase-2 with anti-inflammatory activity. Revista Brasileira de Farmacognosia. 2016;26(1):50-55. DOI: https://doi.org/10.1016/j.bjp.2015.08.013.

40. Rennert K, Steinborn S, Gröger M, Ungerböck B, Jank A-M, Ehgartner J, et al. A microfluidically perfused three dimensional human liver model. Biomaterials. 2015;71:119-131. DOI: https://doi.org/10.1016/j.biomaterials.2015.08.043.

41. Paccaud JP, Schifferli JA, Baggiolini M. NAP-1/IL-8 induces up-regulation of CR1 receptors in human neutrophil leukocytes. Biochemical and Biophysical Research Communications. 1990;166(1):187-192. DOI: https://doi.org/10.1016/0006-291X(90)91929-M.

42. Souza GR, Cunha TM, Silva RL, Lotufo CM, Verri WA, Funez MI, et al. Involvement of nuclear factor kappa B in the maintenance of persistent inflammatory hypernociception. Pharmacology, Biochemistry and Behavior. 2015;134:49-56. DOI: https://doi.org/10.1016/j.pbb.2015.04.005.

43. Alfaro C, Sanmamed MF, Rodríguez-Ruiz ME, Teijeira Á, Onate C, González Á, et al. Interleukin-8 in cancer pathogenesis, treatment and follow-up. Cancer Treatment Reviews. 2017;60:24-31. DOI: https://doi.org/10.1016/j.ctrv.2017.08.004.

44. Vannini F, Kashfi K, Nath N. The dual role of iNOS in cancer. Redox Biology. 2015;6:334-343. DOI: https://doi.org/10.1016/j.redox.2015.08.009.